Another favorite of mine is, "Faith is the bird, that feels the dawn, and sings while it is yet dark"
There are a lot of scriptures in the bible dealing with faith. One I know says that "The measure of faith is given to every man" in Romans 12:3.
We also know, Without faith it is impossible to please God as found in Hebrews 11:6
King James Version: "But without faith it is impossible to please him, for he that cometh to God must believe that he is, and that he is a rewarder of them that diligently seek him"
I have faith that in writing this BLOG, I will be healed of type II diabetes and God willing, a lot of others who follow this blog will also be healed. That is my prayer every night before I go to bed. May God Bless you and have mercy on you and heal you of your diseases including but not limited to diabetes.
I would like to share another scripture for everyone out there.
3 John 1:2
Viewing the 1769 King James Version. Click to switch to 1611 King James Version of 3 John 1:2Beloved, I wish above all things that thou mayest prosper and be in health, even as thy soul prospereth.
Let's summarize thus far: We cannot please God without faith, so therefore God provided for us in that He gave each one of us the measure of faith. he is also a rewarder of them that diligently seek him. His greatest wish is that we would prosper and be in health even as our soul prospereth.
HE wants us to prosper and to be in good health. Our soul prospers as we "diligently seek Him".
We are created in His image and we are unique. there are currently as of 2009 an estimated 6.5 billion people on planet earth. Total number of people who ever lived from Adam to present day is estimated to be 120 billion. Amazing isn't it? The real amazing part comes in when you realize NO ONE ever had exactly the same finger prints as another person. Let's go one better. How many people on earth share the exact same DNA code? The answer is the same as finger prints. NONE. Look at this excerpt from an article on DNA identification: (link) see link for details:
Link To Uniqueness of DNA
| DNA/CRIMINAL JUSTICE | ||
How Can DNA Sequences Identify Individuals?
| 1 | 2 | 3 | 4 | 5 |
Most people share very similar gene sequences, but some regions of DNA sequence have been found to vary from person to person with high frequency. Comparing variation in these regions allows us to answer the question of whether two different DNA samples come from the same person.
The FBI’s forensic DNA identification system probes thirteen such regions in the genome. Sequences in these special regions involve multiple repetitions of short combinations of letters, such as GATA. Easily detectable differences between people lie in the number of repeats that occur in both copies of their DNA in these regions. For example, at one of these regions a person might have inherited four repeats (GATAGATAGATAGATA) from their father and six repeats (GATAGATAGATAGATAGATAGATA) from their mother at the same location in the genome. Another person might inherit eight repeats (GATAGATAGATAGATAGATAGATAGATAGATA) from their father and five repeats (GATAGATAGATAGATAGATA) from their mother.
When two DNA samples match completely in a large number of regions, such as the 13 used in the FBI’s CODIS system, the probability that they could have come from two unrelated people is virtually zero. This fact makes DNA identification extremely reliable.
No comments:
Post a Comment