You Are Unique

What is faith? Let's look at Hebrews 11:1  "Now faith is the substance of things hoped for, the evidence of things not  seen"

Another favorite of mine is, "Faith is the bird, that feels the dawn, and sings while it is yet dark"

There are a lot of scriptures in the bible dealing with faith. One I know says that "The measure of faith is given to every man" in Romans 12:3.

We also know,  Without faith it is impossible to please God as found  in Hebrews 11:6
  King James Version:  "But without faith it is impossible to please him, for he that cometh to God must believe that he is, and that he is a rewarder of them that diligently seek him"

I have faith that in writing this BLOG, I will be healed of type II diabetes and God willing, a lot of others who follow this blog will also be healed. That is my prayer every night before I go to bed. May God Bless you and have mercy on you and heal you of your diseases including but not limited to diabetes.

I would like to share another scripture for everyone out there.

3 John 1:2

Viewing the 1769 King James Version. Click to switch to 1611 King James Version of 3 John 1:2

Beloved, I wish above all things that thou mayest prosper and be in health, even as thy soul prospereth.

Let's summarize thus far: We cannot please God without faith, so therefore God provided for us in that He gave each one of us the measure of faith. he is also a rewarder of them that diligently seek him. His greatest wish is that we would prosper and be in health even as our soul prospereth.

HE wants us to prosper and to be in good health. Our soul prospers as we "diligently seek Him".

We are created in His image and we are unique. there are currently as of 2009 an estimated 6.5 billion people on planet earth. Total number of people who ever lived from Adam to present day is estimated to be 120 billion. Amazing isn't it? The real amazing part comes in when you realize NO ONE ever had exactly the same finger prints as another person. Let's go one better. How many people on earth share the exact same DNA code? The answer is the same as finger prints. NONE. Look at this excerpt from an article on DNA identification: (link) see link for details:

Link To Uniqueness of DNA

	DNA/CRIMINAL JUSTICE

How Can DNA Sequences Identify Individuals?

1

2

3

4

5

Most people share very similar gene sequences, but some regions of DNA sequence have been found to vary from person to person with high frequency. Comparing variation in these regions allows us to answer the question of whether two different DNA samples come from the same person.
The FBI’s forensic DNA identification system probes thirteen such regions in the genome. Sequences in these special regions involve multiple repetitions of short combinations of letters, such as GATA. Easily detectable differences between people lie in the number of repeats that occur in both copies of their DNA in these regions. For example, at one of these regions a person might have inherited four repeats (GATAGATAGATAGATA) from their father and six repeats (GATAGATAGATAGATAGATAGATA) from their mother at the same location in the genome. Another person might inherit eight repeats (GATAGATAGATAGATAGATAGATAGATAGATA) from their father and five repeats (GATAGATAGATAGATAGATA) from their mother.
When two DNA samples match completely in a large number of regions, such as the 13 used in the FBI’s CODIS system, the probability that they could have come from two unrelated people is virtually zero. This fact makes DNA identification extremely reliable.

Still don't think you are unique? Let's look at another scripture.

Luke 12;7 "Indeed, the very hairs on your head are all numbered. Don't be afraid, you are worth more than many sparrows"

Let's face it. We are all different. We are all similar, in that barring birth defects. crippling, disfiguring accidents, etc. we all have 10 fingers, 10 toes, two legs, two eyes, two hands etc. We are pretty easy to identify at a distance that we are human, male or female etc.

On the other hand, we are unique enough that God knows every one of us by name, and he knows how many hairs each one of us have on our heads. He also died on the cross at Calvary for each and every one of us for individually for the remission of our sins. He also spoke to us in Jeremiah 29:11 to tell us: "For I know the plans I have for you, declares the Lord, plans to prosper you, and not to harm you, plans to give you a hope and a future"

I encourage you to praise the lord for your uniqueness, and thank Him for His plans for you, because He wants to prosper you and he wants you to be in good health. Now, why would I ask you to praise the Lord for your health and that you welcome the plans HE has for you? Good question. In Psalm 22:3 and in 114:2, we are told, "GOD in habits HIS praises". What does that mean? It means that God DWELLS in the atmosphere of HIS Praise, making praise a vehicle of faith which brings us into the presence and power of God.  SEE:

http://www.victorious.org/praise.htm

There is NO better place to be, than in the presence and power of God. This is place where you can experience divine healing. In future posts, I am going to share stories from scripture of divine healing and faith.

My prayer is that these posts will bless you and bring you closer to the Lord.

Dan