Healing Scriptures

This BLOG has been about curing if possible and good control of if not possible...........TYPE 2 DIABETES. I have given my best shot at finding the latest supplements, exercise programs, diet recommendations, safest prescription drugs, that exist out there at the moment.

In the process of doing that, I do NOT want to neglect that fact that HEALING is still available today. It did not perish with the risen Jesus after his ascension. If you ever watched a movie where someone was deathly ill or had been in a serious accident etc., someone always says, "It is in God's hands now, there is nothing more we can do".

Most movies present that as a death sentence of sorts. I have never felt that way. In fact I pray every day for myself and others that Christ would have mercy on us and HEAL us and RESTORE us to perfect health. I believe that health is available today and that diabetes can be cured. Following are some chosen scriptures that I pray you will take to heart and refer to in your daily prayers.

Dan

Isaiah 53:4-5 (KJV)

 Surely he hath borne our griefs, and carried our sorrows: yet we did esteem him stricken, smitten of God, and afflicted.

 But he was wounded for our transgressions, he was bruised for our iniquities: the chastisement of our peace was upon him; and with his stripes we are healed.

Matthew 11:5-7

King James Version (KJV)

5 The blind receive their sight, and the lame walk, the lepers are cleansed, and the deaf hear, the dead are raised up, and the poor have the gospel preached to them.
6 And blessed is he, whosoever shall not be offended in me.
7 And as they departed, Jesus began to say unto the multitudes concerning John, What went ye out into the wilderness to see? A reed shaken with the wind?

3 John 1:2

Beloved, I wish above all things that thou mayest prosper and be in health, even as thy soul prospereth.

Exodus 15:25,26

So he cried out to the LORD, and the LORD showed him a tree. When he cast it into the waters, the waters were made sweet.
There He made a statute and an ordinance for them, and there He tested them, and said, “If you diligently heed the voice of the LORD your God and do what is right in His sight, give ear to His commandments and keep all His statutes, I will put none of the diseases on you which I have brought on the Egyptians. For I am the LORD who heals you.

Exodus 23:25

So you shall serve the LORD your God, and He will bless your bread and your water. And I will take sickness away from the midst of you.

Psalm 30:2

O LORD my God, I cried out to You, and You healed me.

Psalm 103:2,3,5

Bless the LORD, O my soul,
And forget not all His benefits:
Who forgives all your iniquities,
Who heals all your diseases,
Who satisfies your mouth with good things,
So that your youth is renewed like the eagle’s.

Psalm 107:20

He sent His word and healed them,
And delivered them from their destruction's.

Proverbs 4:20-22

My son, give attention to my words;
Incline your ear to my sayings.
Do not let them depart from your eyes;
Keep them in the midst of your heart;
For they are life to those who find them,
And health to all their flesh.

Does God Still Answer Prayer? (YES He Does)

I listened to Joel Olsteen on TV at around midnight EST this morning as I came down stairs to check on my BG level. He is a TV evangelist/preacher and I was impressed with the "Child Like Faith" of this young girl Jamie Zimmerhanzel's prayers concerning keeping a calf on her father's farm. Her Dad had indicated that it must be a BLACK  female calf and then she could keep it. With faith that only a child seems to have sometimes, Jamie prayed earnestly every day and believed in her heart, and never doubted that God would answer her prayer.

Hebrews 11:6

King James Version (KJV)

⁶ But without faith it is impossible to please him: for he that cometh to God must believe that he is, and that he is a rewarder of them that diligently seek him.

Is there something that you are earnestly praying for? Perhaps being healed of diabetes as an example? or is your family in need of another miracle in finances? another family member's health etc.?

I urge you to go to the book of Romans chapter 10:9-10 and read it and surrender your will to God's first.

"That if thou shalt confess with the mouth, the Lord Jesus Christ and believe in thine heart that God hath raised Him from the dead, thou shalt be saved. For with the mouth confession is made unto salvation and with the heart believing unto righteousness"

If you believe that in your heart, that makes you a child of God and you are heaven bound. It will be the single most important thing you can do in your life.

Then you can go to God and ask Him to fill you with faith. You can go before the God of the universe in Jesus name and ask for God's help, His mercy, His grace in every area of your life. Are you strugling with sin? God will forgive you and strengthen you in the most Holy Spirit and make you an overcomer. I plead with you to do it today.

The bible also says:

John 16:24
King James Bible (Cambridge Ed.)
Hitherto have ye asked nothing in my name: ask, and ye shall receive, that your joy may be full.

Don't say, "I would like to, however I am NOT worthy". You would be right as NONE of us are worthy. The bible says while we were yet sinners, He died for us. His substitutionary death on the cross of Calvary paid the debt for your sins that you might have eternal life.

Come to Him just as you are, sit a spell at the foot of the cross and ponder what Jesus did for you....what He accomplished for you that day at Calvary.

Dan

Here is a link to more on Jamie's story. It will build your faith:

http://neogaf.com/forum/showthread.php?t=457784

EXCERPTS:

---

I'm not a believer myself, but I'm genuinely interested in experiences or stories people have had/witnessed that left no doubt in their minds in the presence of a higher power. I'd like to say that I can promise that no one will critique or criticize your story, but know that I won't and that isn't what this thread was created for. If you come into this thread planning to tear down someone's beliefs, insult religion, demand physical evidence, etc. there are countless threads on this board you can post in. Don't do it here.

I understand it's a completely personal thing and its fine if you don't want to share. However, if people are willing to lay their experiences out on the table, you'd be contributing to what could end up being a pretty amazing thread.

I'll start first with a story I heard from Joel Osteen (I've only seen one of his sermons, and this was the story he told). I'll quote the person who wrote about the story so I don't have too....


One of the most amazing stories I heard from Joel Osteen speak was a story about a beautiful calf and a 7 year old girl named Jamie. Jamie's family said in order for her to keep one of the cows it has to be female and the cow has to be black. So after she knew what she had to do she began praying daily for the cow to meet the terms laid out by her family.



When the calves were born the second of four calves was a girl and it was black. And if that was not enough of a miracle the baby calf was born with white on her forehead in the shape of a J. This was as if the angels said this calf is meant for Jamie stamped with a J on her forehead. The father was so stunned as he saw this little calf just sitting there knowing it was Jamie's. He went and got the camera and took a picture.


Unless someone put a J stencil on that cow's head and spray painted it white, I find it hard to believe that this was a hoax, and calling it a coincidence is an extraordinarily, colossally, large stretch......

The 10 Commandments

I thought with the current state of Planet earth, it might be appropriate to post the 10 commandments:

Hung By The Tongue by Francis Martin

I thought I would do a book review on a book I had read years ago, and recently found again in a plastic bin in the basement. It is entitled "Hung By The Tongue" by Francis P. Martin. The concept of the book is very complex and yet utterly simple. In essence the theme of the book is, "What you say is what you get".

The book was offered by Francis P. Martin, Bible Teaching Seminars, Books and Tapes, POB 52444, Lafayette, Louisiana 70505 (318-984-1850). One could conclude it is therefore a biblical based book with plenty of scripture references to back up the concept of how important your words really are. If that is what you think.......you are RIGHT.

LINK TO purchase book if desired:

http://www.amazon.com/s?ie=UTF8&keywords=hung%20by%20the%20tongue&page=1&rh=n%3A283155%2Ck%3Ahung%20by%20the%20tongue

In the introduction the very first statement is: "What You Say Is What You Get." SEE Mark 11:23
"Do you see this mountain? If you want to move it, all you have to do is speak to it and if you believe what you say, you can have it"

You can have whatsoever you say.....these are true words and scriptural.



Do you have mountains in your life? I do.

The entire book is about controlling the words that come out of your mouth, since the words that come out of your mouth control your future. Your words essentially are NOT mere words, they go forth and accomplish the purpose for which they were sent. If you continually speak POVERTY, then you are bringing poverty upon yourself. If you continually speak of illness and disease, then you are bringing illness and disease upon yourself.

The opposite is also true, if you continually speak of abundance, having all your needs met, claiming health etc. then your words have power over your own destiny.

To control your MOUTH, you must first control your THOUGHTS. Right or wrong thinking is the basis for controlling your words. Proverbs 23:7....."As a man thinketh in his heart, so IS HE."

The bible is full of spiritual principles such as the law of sowing and reaping. Luke 6:37-38 indicates that whatever we give out (sow), we will have it multiplied back to us (reap).

How then do we control our thoughts?

There are only (3) places from which your thoughts come from:

• Your five senses (everything you have known, experienced since your were born into the world)
• Satan (the Devil) can bombard your mind with thoughts / John 13:2 "The devil put the thought of betrayal into Judas' mind."
• Lastly GOD can also put thoughts into your heart and mind by His Holy Spirit.

God deals with your spirit and the five senses deals with your mind. Romans 8:7 indicates the natural mind alone or the sensual part of you cannot know God. God speaks to you through your spirit and your spirit speaks to your mind. For this to work properly your mind must be renewed by the word of God according to Romans 12:2.

Romans 12:2

King James Version (KJV)

² And be not conformed to this world: but be ye transformed by the renewing of your mind, that ye may prove what is that good, and acceptable, and perfect, will of God.

First one would get his thoughts into God's Word (The Bible) and start reading scripture daily, This is the process by which we are transformed by the renewing of our minds. In II Cor 10:5 it says that we should be "Casting down imaginations or reasoning's and every high thing that exalteth itself against the knowledge of God"

What is the process?

Thoughts are the initial phase - What about the thought that just came into your mind? What are you going to do with it? If it is a bad thought, it would not be wise to dwell on it. If you do dwell on it, then the mere thought now becomes an imagination. If you continue to dwell on the imagination, then it becomes a stronghold. Dismissing initial bad thoughts is easier than letting your imagination run wild with it until it becomes a stronghold and now controls you, your spoken words and your future.

The bible says that "Out of the abundance of the heart, the mouth speaks."

In Matthew 15:17 Jesus said, "Don't you understand that whatsoever entereth in at the mouth goeth into the belly, and is cast out into the draught, but those things which proceed out of the mouth come forth from the heart and they defile a man"

Look again in Luke 6:43-45 Jesus compares us to a tree.

"Make the tree good and the fruit will be good and make the tree bad and the fruit is bad"

In James Chapter 3 he asks in verse 12..."Can a fig tree bear olives? a Vine, figs? or can a fountain send forth both salt and fresh water?

The book is a very good read and I recommend it for anyone wanting to change his or her future for the better.

In Proverbs 18:21, it says, "Death and life are in the power of the tongue."

The practical side of an in depth understanding of what Francis martin is teaching here is that if you want health, then SPEAK HEALTH, if you want your financial needs taken care of then SPEAK ABUNDANCE.

Proverbs 12:18 "The tongue of the wise is health"
Proverbs 12:6 "The mouth of the upright shall deliver him"
Proverbs 18:6-8 "A fool's lips enter into contention and his mouth calleth for strokes. A fool's mouth is his destruction, and his lips are the snare of his soul. The words of a talebearer are as wounds, and they go down into the innermost parts of the belly"

Romans 10:17 "So then faith cometh by hearing and hearing by the word of God"
Philippians 4:19 "My God shall supply all your need" /see verse 18 "I have all",and "I am full" see verse 13 "I can do all things"

Search the scriptures daily for these truths, buy a copy of this book and then spend 20 Min's alone in prayer before you head out the door to work speaking out loud abundance, health, happiness, divine protection. Speak that your blood lipid profile must change and come into alignment with the words you speak. Speak that you are free of diabetes, high blood pressure, poverty, lack of gainful employment and thankfully praise God for supplying all your need through his riches in Christ Jesus.

God bless and have a Happy and safe Thanksgiving.

Dan

Philippians 4:19

King James Version (KJV)

¹⁹ But my God shall supply all your need according to his riches in glory by Christ Jesus.

Healing Scriptures

Mark 5:35-40

"While he yet spake, there came from the ruler of the synagogue's house certain which said, Thy daughter is dead; why troublest thou the Master any further? As soon as Jesus heard the word that was spoken, he saith unto the ruler of the synagogue, Be not afraid, only believe."

Believing is so important.

"And he suffered no man to follow him, save Peter, and James, and John the brother of James. And he cometh to the house of the ruler of the synagogue, and seeth the tumult, and them that wept and wailed greatly. And when he was come in, he saith to them, "Why make ye this ado, and weep? the damsel is NOT dead, but sleepeth. And they laughed him to scorn."

Jesus then took the UNbelievers out of the room (UNbelief can stop healing).

Mark tells us, "He taketh the father and mother of the damsel, and them that were with him, and entereth in where the damsel was lying. And he took the damsel by the hand, and said unto her, Talitha cumi; which is being interpreted, Damsel I say unto thee ARISE. And straightway the damsel arose and walked; for she was of the age of twelve years. And they were astonished with a great astonishment."

What did Jesus do again?

(2) THINGS:

He touched her hand
He SPOKE

He issued a command for her to "GET UP" even though he knew she was dead.

What didn't she do?

She didn't lie there and say,  "I am dead, I can't do that"

SHE GOT UP.

JESUS SAID: "He that believeth on me, the works that I do shall he do also; and greater works than these shall he do, because I go unto my Fahter John 14:12

"Faith is the subtance of things hoped for and not yet seen"

OR one of my favorites:

"Faith is the bird that FEELS the dawn and SINGS while it is yet dark"


Dan

God Formed Adam Out Of The dust Of The Ground

The biblical account of creation indicates that God formed Adam out of the dust of the Ground, however Adam did not have life until God breathed into his nostrils the breath of life and then Adam became a living soul.


Job 27:3
King James 2000 Bible (©2003)
All the while my breath is in me, and the spirit of God is in my nostrils;


The physical body itself is made up of I believe 59 elements, plus oxygen, water etc. I am going to post a link to the elemental make up of the human body and why I believe it is so important not to just treat symptoms with drugs and not take into account the whole man and the interaction of all of elements of the body. We need to get away from just treating symptoms or masking symptoms by the use of prescription drugs many of which cause more harm than good and never get to the REAL reason we have diabetes or any other disease. It is because our bodies through wrong diet, lack of exercise, etc. we are OUT OF BALANCE. It is amazing to me how little of some trace minerals/elements we need and yet if one or more are lacking, a host of symptoms and diseases can develop.


Check out the link below for a list of the make up of our human bodies.

Dan

http://web2.airmail.net/uthman/elements_of_body.html

The Tree of Life In The Garden Of Eden

I make no bones about being a Christian and although by no means a biblical scholar, I consider myself a student. I have always been fascinated by the story of our beginnings in the garden Of Eden and especially the (2) primary trees located there which were "The Tree Of Life" and "The Tree Of The knowledge Of Good And Evil".

I used to think, wow, if I had been Adam, I would never have eaten of the forbidden tree of the knowledge of good and evil. Look at all the misery I would have saved the human race. Of course I know that I would have sinned and so would you. We are all sinners and have ALL fallen short of the Glory of God.

None-the-less it is interesting to have a working knowledge of the Tree Of Life as it will play a significant role in your future if you have made the Lord Jesus Christ, your Lord and Saviour and accepted His substitutionary death on the cross for the remission of your sins. If you have never done that, I encourage you to do it today. The bible says that TODAY is the day of salvation, NOT tomorrow. Tomorrow may not come for you in this life. No one has a lease on life.

For he saith, I have heard thee in a time accepted, and in the day of salvation have I succored thee: behold, now is the accepted time; behold, now is the day of salvation. (II Corinthians 6:2)

Let's get on to the Tree Of Life. Here is a link that says it better than I can by trying to RE-invent the wheel:

Dan

http://www.israel-a-history-of.com/biblical-garden-of-eden.html

EXCERPT:



This was the perfect home for man. It was created before sin. It's beauty was perfect. The lush vegetation contained fruit trees never before known to man.
A river is said to "wander" through the Biblical Garden of Eden, providing the Garden's watering source. The rivers source is said to be in Eden, though not in the Garden itself.
This river starts somewhere in Eden, flows into the Garden, and winds itself through the Garden. Once outside the Garden, it splits into four headwaters.
This river is fed through the subterranean reservoirs (Gen. 2:6) that made up the antediluvianwater cycle, which would have watered the Biblical Garden of Eden.
These four headwaters are the Euphrates River, the Gihon River, the Pishon River, and the Hiddekel, or Tigris, River. A preliminary evaluation would suggest two of these rivers no longer exist.
However, the development of satellite imaging, and incredible archaeological finds in Turkey, have led many to believe the Biblical Garden of Eden has been found.The story of the Biblical Garden of Eden, however, first begins with what God had planted in the Garden, which helped contribute to its Divine uniqueness. The word Eden literally means, "delight". It was a garden of delight, full of heavenly fruit growing on trees! Genesis 2:9 describes God's handiwork.
"And out of the ground the Lord God caused to grow every tree that is pleasing to the sight and good for food.."
This garden was full of color, a beautiful array of flowering colors, pleasing to the sight. The aroma was surely one of sweetness, and the food brought healing to Adam and Eve's mortal bodies. It was pure paradise. Two trees, however, stood out amongst the others.
The Trees of Eden
"And the Lord God had planted a garden in the east.....And the Lord God made all kinds of trees grow out of the ground-trees that were pleasing to the eye and good for food. In the middle of the garden were the tree of life and the tree of the knowledge of good and evil." - Gen. 2:9
The Tree of Life
In the middle of the Biblical Garden of Eden grew two remarkable trees. Genesis 3:22 mentions that the fruit from one of these trees produced eternal life.
God specifically says that man must not be allowed to "reach out his hand and take also from the tree of life and eat, and live forever".
God instructs Adam and Eve to eat from any tree in the Biblical Garden of Eden, except for the "tree of the knowledge of Good and Evil". He never makes any mention about not eating from the Tree of Life.
Adam and Eve were meant to enjoy the fruit of this heavenly tree at will. In essence, this tree would enable Adam and Eve to live forever. It possessed divine powers of healing and regeneration.
Only after Adam and Eve disobey, does He restrict them from the Tree of Life. It is quite remarkable to think that God took the gift of eternal life and originally included it in a fruit!
The Tree of Life possesses a fascinating place in Scripture. This tree possessed such powers that it became necessary to place a Cherubim and a flaming sword in front of it to prevent man from eating of it. The Cherubim, according to Ezekiel, was the highest of the angelic realm (Ezekiel 1:4-28; 10:1-22).
In Revelation 22:2 it is this same Tree of Life that stands on each side of the River of the Water of Life, which flows through the New Jerusalem, established when the Messiah comes again. The tree is said to bear "twelve crops of fruit, yielding its fruit every month. And the leaves of the tree are for the healing of the nations".God intended to bring forth healing and life to Adam and Eve through this Tree of Life. When His kingdom is established on earth, its leaves will bring healing and life to the nations.

FAITH is KNOWING That It WILL HAPPEN Before Knowing It Can Happen

I am a big fan of faith in action stories and the bible is full of them. The bible says that if we have FAITH as a grain of mustard seed (smallest of seeds), then nothing shall be impossible unto us.

Mark 4:30-32, Luke 13:18-20].
Jesus says, "if you have faith as a mustard seed, you will say to this mountain, move from here to there, and it will move; and nothing will be impossible for you" [Matthew 17:20, Luke 17:6]. Jesus promises "it will move" [Matthew 17:20]; "it will be done" [Matthew 21:21]; it "shall come to pass" [Mark 11:23]; and it will "obey you" [Luke 17:6].
Jesus talks about the quantity of faith that it takes to do the impossible. Jesus compares mustard seeds to mountains. Jesus says that it only takes a mustard seed amount of faith [confidence] in the principles of the Kingdom of God to remove huge barriers such as mountains. Jesus said if you have a mustard seed amount of faith in the Word of God, nothing would be impossible to you.

I LOVE this particular story of FAITH IN ACTION:

Mark 5:25-34

King James Version (KJV)

²⁵And a certain woman, which had an issue of blood twelve years,
²⁶And had suffered many things of many physicians, and had spent all that she had, and was nothing bettered, but rather grew worse,
²⁷When she had heard of Jesus, came in the press behind, and touched his garment.
²⁸For she said, If I may touch but his clothes, I shall be whole.
²⁹And straightway the fountain of her blood was dried up; and she felt in her body that she was healed of that plague.
³⁰And Jesus, immediately knowing in himself that virtue (MY INPUT /dunamis power..from which we get our word dynamite) had gone out of him, turned him about in the press, and said, Who touched my clothes?
³¹And his disciples said unto him, Thou seest the multitude thronging thee, and sayest thou, Who touched me?
³²And he looked round about to see her that had done this thing.
³³But the woman fearing and trembling, knowing what was done in her, came and fell down before him, and told him all the truth.
³⁴And he said unto her, Daughter, thy faith hath made thee whole; go in peace, and be whole of thy plague.

I have read that in the Hebrew language, Faith is the catalyst that actually makes things happen.

I have seen it described this way:

"Faith is KNOWING it will happen BEFORE knowing that it can happen"

Read that last statement TWICE. If you let it sink into your being, you will begin to get a grasp on how faith actually works.

Dan

Faith Based Thinking For Healing

In the old testament there are (7) redemptive names for God:

• Jehovah Jireh  /  Jehovah will provide or make a provision where there is a Need
• Jehovah - Nisi  /  The Lord our Banner
• Jehovah - Shalom  /  The Lord  our Peace
• Jehovah - Shammah  /  The Lord is Present
• Jehovah - Tsidkenu  /  The Lord our Righteousness
• Jehovah Ra-ah  /  The Lord our Shepherd
• Jehovah- Rapha  /  The Lord my Healer

"By His stripes, we are healed (I Peter 2:24)

"And Jesus went about all Galilee, teaching in their synagogues, and preaching the gospel of the Kingdom, and healing all manner of sickness and all manner of disease among the people" Matthew 4:23

 

Mark 16:17-18

King James Version (KJV)

¹⁷And these signs shall follow them that believe; In my name shall they cast out devils; they shall speak with new tongues;
¹⁸They shall take up serpents; and if they drink any deadly thing, it shall not hurt them; they shall lay hands on the sick, and they shall recover.

Acts 4:30

King James Version (KJV)

³⁰By stretching forth thine hand to heal; and that signs and wonders may be done by the name of thy holy child Jesus.

Dan

Thoughts on Type 2 Diabetes

I was sitting at my computer tonight and thinking about "If One Size Fits All" when it comes to type 2 Diabetes. Are we all the same height ?, the same weight ?, the same personality ?. Do we all have the same DNA ?, the same fingerprints ?, the same likes and dislikes ?. Are we all the same sex ?, do we all have the same hair ? the same talents ? the same drive and ambition ? the same purpose in life ?

Do we all dress the same ? think alike ? Etc.

The obvious answer is that NO we are not the same. ....................and yet.........if you are reading this blog it is likely that you or someone you know has Type 2 diabetes. Even though we are all different, we have type 2 diabetes in common. We may be from different backgrounds, different parts of the country or the world for that matter and yet we share Type 2 Diabetes and hopefully share a desire to reverse it and live as normal a life and as long a life as humanly possible.

I don't know anyone who wants their blood glucose levels to be out of control, or who can't wait to have diabetic neuropathy etc.

Despite our differences, there are some things we can all do to help reverse this disease that we have been diagnosed with.

We CAN Control the amount and type of food and drink that we put into our mouths. We can decide by an act of will and faith to eat less today. We can decide to eat more fresh fruit and vegetables. We can decide to exercise more, especially weight resistance training and taking a walk every day. We can drink more water. We can make a list of supplements that we can afford and start taking them every day. We can all drink "Green Smoothies" every day.

We can check our BG levels more frequently and keep a notebook on what foods spike our blood glucose levels.  We can resolve to not eat after dinner in the evening. We can convince ourselves that we do NOT need some sort of sweet, or desert, or a piece of chocolate, or a cookie after every meal or before we go to bed at night. We can all remove temptation by simply NOT buying rich deserts or extra cookies for the holidays and then end up eating them after all the company is gone.

We can all endeavor to stay on top of recent and historical research and apply those principles that we have learned on getting better control of our blood sugar levels. We can decide to take some responsibility for what we eat and not depend on another prescription drug or an increased dosage of the ones we are already on.

We can CHANGE. We can decide to make positive changes in our exercise and eating habits and stick with it.

Philippians 4:13

New King James Version (NKJV)

¹³ I can do all things through Christ^[a] who strengthens me.

John 14:14 "If ye shall ask any thing in My name, I will do it."

Ps. 103:2-3 "Bless the LORD, O my soul, and forget not all His benefits: Who forgiveth all thine iniquities; Who healeth all thy diseases

Merry Christmas to all of you. Dan

Refresher On Best ideas For Reversing/Defeating Type 2 Diabetes

Thought I would do an UPDATE refresher on defeating Type 2 Diabetes:

• Exercise more / do BOTH weight resistance training and aerobics. Weight resistance can be your own body weight and NOT necessarily free weights. I prefer two 20 lb dumbells for squats, and overhead exercises, along with push ups, and abdominal exercises combined with brisk walking. 
• Supplements including cold milled pressed organic flax seeds with your breakfast (mine is normally OATMEAL), CQ10, Alpha Lipoic Acid, calcium and magnesium supplement, 5000 units of Vitamin D3, 1000 mg of vitamin C, a multi vitamin such as Your Life vitamins, All day energy greens Cod Liver oil caps, liquid cold pressed organic flax seed oil, fish oil caps, BEST - Krill oil), bilberry and lutein for eye protection, good prostate supplement if you are a man (Product called best prostate)
• Green smoothies using a (Ninja) or Vita Mixer or similar product - my favorite is 4 stalks of fresh crisp celery, 1 medium size apple, 1 medium size carrot, handful of baby spinach, tablespoon of yogurt, 12-16 ounces of cold water, 1/2 banana & 2 stevia packets and 4 or 5 ice cubes, perhaps an Emergen-C 1000 mg vit C packet - blend until it is a smooth liquid drink. 
• Looking into NOPALEA  for benefit of Nopal cactus juice - help eliminate inflammation and benefit of lowering blood glucose levels
• Possibility of Milagro De La Selvo Tea tea added to your regimen 
• Avoid highly processed sugar, sweets, bread, carbohydrates and avoid diet and regular carbonated sodas and drinks - drink more WATER - eat more FRESH fruit.  
• Eat NUTS, walnuts, cashews, peanuts, almonds .....IN THEIR RAW STATE IF POSSIBLE etc. and also take a tablespoon or two of Extra Virgin Coconut oil every day along with using extra virgin olive oil also- AVOID LIKE THE PLAGUE hydrogenated or partially hydrogenated oils / READ LABELS

Get right with the LORD, or nothing else matters:

Dan

King James Version: Ephesians Chapter 1

1 Paul, an apostle of Jesus Christ by the will of God, to the saints which are at Ephesus, and to the faithful in Christ Jesus:

2 Grace be to you, and peace, from God our Father, and from the Lord Jesus Christ.

3 Blessed be the God and Father of our Lord Jesus Christ, who hath blessed us with all spiritual blessings in heavenly places in Christ:

4 According as he hath chosen us in him before the foundation of the world, that we should be holy and without blame before him in love:

5 Having predestinated us unto the adoption of children by Jesus Christ to himself, according to the good pleasure of his will,

6 To the praise of the glory of his grace, wherein he hath made us accepted in the beloved.

7 In whom we have redemption through his blood, the forgiveness of sins, according to the riches of his grace;

8 Wherein he hath abounded toward us in all wisdom and prudence;

9 Having made known unto us the mystery of his will, according to his good pleasure which he hath purposed in himself:

10 That in the dispensation of the fulness of times he might gather together in one all things in Christ, both which are in heaven, and which are on earth; even in him:

11 In whom also we have obtained an inheritance, being predestinated according to the purpose of him who worketh all things after the counsel of his own will:

12 That we should be to the praise of his glory, who first trusted in Christ.

13 In whom ye also trusted, after that ye heard the word of truth, the gospel of your salvation: in whom also after that ye believed, ye were sealed with that holy Spirit of promise,

14 Which is the earnest of our inheritance until the redemption of the purchased possession, unto the praise of his glory.

15 Wherefore I also, after I heard of your faith in the Lord Jesus, and love unto all the saints,

16 Cease not to give thanks for you, making mention of you in my prayers;

17 That the God of our Lord Jesus Christ, the Father of glory, may give unto you the spirit of wisdom and revelation in the knowledge of him:

18 The eyes of your understanding being enlightened; that ye may know what is the hope of his calling, and what the riches of the glory of his inheritance in the saints,

19 And what is the exceeding greatness of his power to us-ward who believe, according to the working of his mighty power,

20 Which he wrought in Christ, when he raised him from the dead, and set him at his own right hand in the heavenly places,

21 Far above all principality, and power, and might, and dominion, and every name that is named, not only in this world, but also in that which is to come:

22 And hath put all things under his feet, and gave him to be the head over all things to the church,

23 Which is his body, the fulness of him that filleth all in all.

Faith Based Healing Stories

I am going to introduce a series of "Faith Based Healing Stories" from different sources in hopes that they will build your faith that YES, you can recover and reverse type 2 Diabetes with the Lord's help. I remember my first grade school teacher was fond of saying, "God helps those that help themselves."

I was born in 1947 and grew up in different times than we have today. I sometimes think to myself, "What Happened?". No denying the times are different, however I take comfort in the scripture that says:

King James Bible Hebrews 13:8
Jesus Christ the same yesterday, and to day, and for ever.

People change, times change, governments change, however Jesus Christ is the same yesterday, today and tomorrow. Here is a Christmas miracle about a young lad who is about my age that happened on Christmas day in 1948.

Following is a LINK to the Christmas miracle..............click on the link below.

LINK to a Christmas miracle From 1948


THE STORY:

A Christmas Miracle - And Many More Answered Prayers

On the eighth day of December 1948, I was just a baby boy of 17 months. I fell from a three-story window, and landed on the sidewalk. I was then carried to the hospital where I was pronounced dead. My grandmother had arrived by the time they were carrying me to the morgue. She told the orderly to unwrap me because I wasn't dead. She said she saw a light shining over my head and saw my toes moving. Indeed I was alive and they rushed me back upstairs.

He Will Not Live to See Christmas

I was very sick and needed brain surgery, but they couldn't do anything to treat me yet because of my fever. On the thirteenth day of December, 1948, they performed the surgery on my head. The doctors, Dr. Duffy Sr., Dr. Duffy Jr., and Dr. Willis did the surgery. They all told my parents, "He will not live to see Christmas." On December 25, Dr. Willis came out of the delivery room crying. He told my dad that he just delivered a perfectly healthy little boy that died in his arms for no reason. He also told Daddy to take me on home, for I would not live long and I deserved to go home.

Prayers Were Answered

The newspaper picked up the story and all of New Bern began to pray for me. My parents and grandparents prayed for me too, and the prayers were answered. I survived. The doctors still did not believe that I would live to be a teenager, but I outlived the doctors. To this day there is only one nurse who had nursed me back to health still alive. Every time she sees me she breaks down and cries. At age 18 I wanted to go in the Army. My doctor told me, “There’s no way you'll be able to.” He explained that any chance blow to my head could cripple or kill me. I prayed that the doctor would release me and the Army would take me. This happened. I served my country for three years including one year in Vietnam. People all over prayed for me and I was protected.

More Answered Prayers

I prayed for a wonderful girl to be my wife and my prayers were answered again. I thank God for her every day. For a year we tried to have a baby, but couldn't. I felt like a failure. We continued to pray and after our seventh anniversary we had a son. My son and my wife almost died the night he was born. People prayed. Sidney survived with no complications.

The doctor told me that it would be impossible for us to have any more children safely. We prayed. Two years and one week later, Rachel was born. Our prayers were answered. Still today I thank God for two wonderful children.

A Second Chance

At age 52 I had a heart attack. A doctor performed open-heart surgery on me to bypass four arteries. While under anesthesia, I saw a light at the end of the hallway. I got up and walked to it. There was a door there and I opened it and walked in. It was an operating room. In there I could see my daddy and my mother. (They are both dead now.) They were standing around the table and there was a bright light. There were angels around the room too. I looked on the table and there was a little baby on it. The baby was me. I looked up at my daddy. He looked right at me and said, “It’s not your turn, then or now. So, go back.”

Still Here Now

I am still here now loving God. I believe in the power of prayer. I've seen it work. I believe in miracles. I thank God in heaven for his help, guidance, and for giving us power through prayer.

(MY INPUT)

I hope that story blessed you and gave you a ray of sunshine in a seemingly world of darkness. When I think of my first grade school teacher's words about God helping those who help themselves, I try and put it into practice. I do the best I can in terms of exercising, trying to eat right etc. and then I give it to the Lord to handle the rest.

God is still on the THRONE and prayer changes things..

Dan

Ps 107:19-20
19 Then they cry unto the LORD in their trouble, and he saveth them out of their distresses. 20 He sent his word, and healed them, and delivered them from their destructions

Our Faith: A Matter Of Transformation

I am going to do a post based on a page from a "One year Daily Devotional Guide for Men On The Go", written by Stephen Arterburn and Bill Farrel. I love this book because you can read it on a daily basis over and over and over again and always discover something NEW inside the same old pages. In other words, It is timeless in its application for us.

August 15th, 2011:

Philippians 3:15-21 "He will take these weak mortal bodies of ours and change them like his own, using the same mighty power that he will use to conquer everything, everywhere."

Christianity is about IMPROVEMENT; it is about transformation. For that reason, we should never be content with just being "better" when our Savior has promised to make everything about us "new".

"Imagine a colony of grubs living in the bottom of a swamp. And every once in a while, one of these grubs is inclined to climb upon a leaf stem to the surface. Then he disappears above the surface and never returns. All the grubs wonder why this is so and what it must be like up there, so they counsel among themselves and agree that the next one who goes up will come back and tell the others.

Not long after that, one of the grubs feels the urge and climbs that leaf stem and goes out above the surface on a lily pad. And there in the warmth of the sun, he falls asleep. While he sleeps, the carapace of the tiny creature breaks open, and out of the inside of the grub comes a magnificent dragonfly with beautiful, wide rainbow-hued iridescent wings. And he spreads those wings and flies, soaring out over the waters. But then he remembers the commitment he has made to those behind, yet now he can't return. They would not recognize him in the first place, and beyond that, he could not live again in such a place. But one thought is his that takes away all the distress: they too, shall climb the stem, and they too, shall know the glory."

JUST as that grub's transformation into a magnificent dragonfly allowed him to soar, so does God's transformation of us through Jesus Christ allow us to spread our wings and fly. When we meet Jesus, we become someone we weren't before, someone capable of doing great things for him.

Dan

King James Bible Genesis 5:1
This is the book of the generations of Adam. In the day that God created man, in the likeness of God made he him;

Faith Based Thinking - Jesus Still Heals Today

There are many stories of healing throughout the bible and from time to time, I would like to share those with you. I think it is important to remember that none of us will survive in this "earthly body" forever whether we are healed of Type 2 Diabetes or any other disease or not. That being said, healing is still available today and  there is a great deal of recorded evidence of healing's taking place all around you. That healing can be physical (which is my purpose in this BLOG for sharing) and it can also be emotional and psychological.

There is a story in the book of John chapter 4:43-54 that I would like to share. I have taken this from a link I often refer to for "Faith Based Healing Stories". FIRST some scriptures from the New Testament book of Matthew:

Matthew 7:7 Ask, and it shall be given you; seek, and ye shall find; knock, and it shall be opened unto you:
8 For every one that asketh receiveth; and he that seeketh findeth; and to him that knocketh it shall be opened.
9 Or what man is there of you, whom if his son ask bread, will he give him a stone?
10 Or if he ask a fish, will he give him a serpent?
11 If ye then, being evil, know how to give good gifts unto your children, how much more shall your Father which is in heaven give good things to them that ask him?
Matthew 18:19 Again I say unto you, That if two of you shall agree on earth as touching any thing that they shall ask, it shall be done for them of my Father which is in heaven.
Matthew 21:22 And all things, whatsoever ye shall ask in prayer, believing, ye shall receive.

Now the Story:



LOCATION MAP
The believed order of Jesus' recorded healing miracles.
Also the numbers in the Contents List above:

to Contents List

Year One - c AD27-28
THE OFFICIALS' DYING SON

John 4:43-54 - After the two days were over (following his meeting with the Samaritan woman at the well), Jesus left and went away to Galilee. (For Jesus himself testified that a prophet enjoys no honour in his own country.) And on his arrival the people received him with open arms. For they had seen all that he had done in Jerusalem during the festival, since they had themselves been present. So Jesus came again to Cana in Galilee, the place where he had made the water into wine. At Capernaum there was an official whose son was very ill. When he heard that Jesus had left Judea and had arrived in Galilee, he went off to see him and begged him to come down and heal his son, who was by this time at the point of death.

Jesus said to him, "I suppose you will never believe unless you see signs and wonders!"

"Sir," returned the official, "please come down before my boy dies!"

"You can go home," returned Jesus, "your son is alive and well."

And the man believed what Jesus had said to him and went on his way.

On the journey back his servants met him with the report, "Your son is alive and well." So he asked them at what time he had begun to recover, and they replied: "The fever left him yesterday at one o'clock in the afternoon". Then the father knew that this must have happened at the very moment when Jesus had said to him, "Your son is alive and well." And he and his whole household believed in Jesus. This, then, was the second sign that Jesus gave on his return from Judea to Galilee. (The first was changing the water into wine, also at Cana, earlier in John 2:1-11) .

Dan

1 John 3:22 And whatsoever we ask, we receive of him, because we keep his commandments, and do those things that are pleasing in his sight.

1 John 5:14 And this is the confidence that we have in him, that, if we ask any thing according to his will, he heareth us:
15 And if we know that he hear us, whatsoever we ask, we know that we have the petitions that we desired of him. 

James 5:16 says, "The effectual, fervent prayer of a righteous man availeth much." The Bible provides scores of powerful examples of prayers being answered. People like Hezekiah, Moses, Joshua, David, Hannah, and Paul received specific answers to their prayers. Even the great leaders in the Bible believed God answers prayers. There are hundreds of verses showing them asking God to change things. 

MORE FAITH Based Thinking / Faith Replaces Fear

I was looking online for some updates on Pastor Henry Wright's healing ministry and teaching specifically on Auto Immune diseases and their cause and cure. I found this BLOG from Robin Sampson, simply called "Robin's Blog" of interest since Type 2 Diabetes is classified as an auto immune disease. As mentioned in a previous BLOG post, Pastor Wright has categorized types of ailments and diseases based on years of successful healing's in this arena.

I am going to post a link to her BLOG and also an excerpt from one of her blog spots on auto immune diseases and the possible link to FEAR in our lives. My prayer is that this blesses you. Dan

LINK to Robin's Blog and Spiritual Roots Of Diseases

EXCERPT:

Fear As a Spiritual Root of Disease
Fear and worry are sin. Fear is a barrier to the promises of God. The scientific community is aware of how our emotions effect our bodies. The limbic system is where our protective emotions originate including fear. The process of creating fear takes place  unconsciously in the brain.
Part of your brain controls the physical response to fear and sends a signal directly to the amygdala which  stimulates the hypothalamus to produce corticotropin-releasing hormone (CRH) that triggers the pituitary gland’s discharge of adrenocorticotropic hormone (ACTH), which stimulates the adrenal gland to secrete cortisol.
Cortisol in the bloodstream causes an increase in glucose production, providing the necessary fuel for the brain and muscles to deal with stress.
Here is an image from HowStuffWorks:

Cortisol is involved in several body functions including:

1. Proper glucose metabolism
2. Regulation of blood pressure
3. Insulin release for blood sugar maintenance
4. Immune function
5. Inflammatory response

Fear is scientifically proven to be a cause of disease. ScienceDaily (Mar. 26, 2008) states intense fear can make our blood clot and increase the risk of thrombosis or heart attack… Anxiety patients have a statistically higher risk of dying from heart disease by a factor of 3 or 4.

The Bible says fear results in heart problems: “Men’s hearts are failing for fear.” Luke 21:26.

Healthy and Unhealthy Fears

Unhealthy fear is not of God. Fear and faith are opposites. We cannot operate in a spirit of faith and a spirit of fear at the same time. We should not fear, because God is with us. God said He will never leave us nor forsake us (Deu 31:6).

Healthy fear (fight or flight) helps us avoid life threatening or dangerous situations is God given. Fear is the beginning of wisdom (Psm 111:10) refers to reverence of God. Unhealthy fear is unbelief rooted in self.

Here is another image from HowStuffWorks.com:

Examples: If I’m shoveling the barn and feel angina this is an example of healthy warning fear or my body telling me to slow down.

An example of unhealthy fear is to allow the angina to plunge me into a downhill spiral of thoughts like “I am going to die; I should  stay in bed; Why is God allowing this?; Who will take care of my children?; I’ll never see my grandchildren grow up?; Woe is me; etc” This type fear leads to a personal pity party. It is not God’s will for me to walk in unhealthy fear.

Though a host encamp against me, My heart will not fear; Though war arise against me, In spite of this I shall be confident. (Ps 27:3)

There is no fear in love; but perfect love casteth out fear: because fear hath torment. He that feareth is not made perfect in love. (1 John 4:18)

For God hath not given us the spirit of fear; but of power, and of love, and of a sound mind. (2 Tim 1:7)

Casting down imaginations, and every high thing that exalteth itself against the knowledge of God, and bringing into captivity every thought to the obedience of Christ; (2 Cor 10:5)

That thou mayest love the LORD thy God, and that thou mayest obey his voice, and that thou mayest cleave unto him: for he is thy life, and the length of thy days (Deut 30:20a)

Dealing with Fear and Worry

I am dealing with these fears with repentance, the washing of the water of the Word (Bible Study), Taking Every Thought Captive, and Thinking on These Things.

So then faith cometh by hearing, and hearing by the word of God” (Romans 10:17).

For whatsoever is born of God overcometh the world: and this is the victory that overcometh the world, even our faith” (I John 5:4).

Above all, taking the shield of faith, wherewith ye shall be able to quench all the fiery darts of the wicked” (Ephesians 6:16).

I have asked God to replace the worry and fear thoughts with gratitude and praise.

Speaking to a large audience, D.L. Moody held up a glass and asked, “How can I get the air out of this glass?” One man shouted, “Suck it out with a pump!” Moody replied, “That would create a vacuum and shatter the glass.”
After numerous other suggestions Moody smiled, picked up a pitcher of water, and filled the glass. “There,” he said, “all the air is now removed.” He then went on to explain that victory in the Christian life is not accomplished by “sucking out a sin here and there,” but by being filled with the Holy Spirit. Today in the Word).

Calling Out A SPIRIT OF DIABETES

I just returned from a 5 1/2 week trip to Ireland. While there my wife and I were engaged in ministry work. During our visit, I had hands laid on me, and prayers said over me including but not limited to, "Commanding the spirit of diabetes to come out of me in the name of Jesus". It was a very powerful experience. It was at the end of a week of seeing people delivered from several different diseases and ailments.

I should mention here that Christ's atoning work on the cross consisted of (3) parts. In scripture the word atonement is mentioned eighty times and it means "to appease, dismiss, or reconcile". This threefold work of Jesus can be found in the book of Isaiah in chapter 53.

• The atonement for sin: "He was wounded for our transgressions" verse 5
• The promise of PHYSICAL HEALING: "By His stripes we are healed" also in verse 5
• The hope of emotional healing: "Surely He has borne our griefs and carried our sorrows......The chastisement for our peace was upon Him" verses 4-5

I mentioned in an earlier post that diabetes is an autoimmune disease. An autoimmune disease is NOT the result of a lack of white corpuscles. The autoimmune diseases are when the white corpuscles ATTACK living flesh and destroy it. Examples of this included Lupus, Chrohn's, Diabetes, Rheumatoid arthritis, and MS.

In one of my reference books entitled "A More Excellent Way" by Pastor Henry W. Wright, he outlines what he feels to be the Spiritual Roots of disease and the pathways to wholeness. I will share two of many scripture references from Henry Wright's book:

:Beloved, I wish above all things, that thou mayest prosper and be in good health, even as thy soul prospereth" 3 John 1:2

"Who forgiveth all thine iniquities , who healeth all they diseases" Psalm 103:3

Henry's belief is that the body attacks itself because the person is attacking themselves spiritually in some form of self-rejection, self-hatred, and self -bitterness. He feels there is a spiritual dynamic at work when your white corpuscles are invisibly redirected to attack living tissue while ignoring the true enemy which is bacteria and viruses. As a person continues to attack themselves spiritually, the body finally agrees as the white corpuscles start attacking the body. This he indicates is a HIGH price to pay for not loving yourself.

Self rejection and self hatred play a large part in many cases of diabetes that Henry's ministry has seen miracles and healing's take place. This can take many forms amongst them not forgiving other's for having wronged you, or not being able to forgive yourself for something you have done. Perhaps the other party has forgiven you, but you can't forgive yourself and it eats at you.

There is also the work of Spirits and for that reason, "the spirit of diabetes" was called out of me and sent back to the pits of hell from whence it came in Jesus name.

I would strongly encourage anyone reading this blog to purchase two books:

"A More Excellent Way", by Pastor Henry W. Wright, Senior pastor of Pleasant Valley Church in Thomaston, Georgia

"Purging Your House and Pruning Your Family Tree", by Perry Stone Ministries (see perrystone.org)

NOW, back to me:

AFTER having the spirit of diabetes taken out of me, I experienced some real world changes that were noticeable immediately:

• Less variation in high and low blood glucose readings, a dramatic decrease in the swing from very low to high
• The cessation of that blood sugar mid morning plummet (in my case always around 11:15AM)
• The cessation of the jitters and the feeling that I have to eat something right now
• Sleeping through the night without getting up two or three times, or wandering around the house at 4AM

I believe there is a difference between a HEALING, and a MIRACLE. I think my situation is a healing. The root cause of the diabetes was very possibly removed in calling out the spirit. Committing myself back to God and praising Him for my deliverance.

In other words, I believe I will get progressively BETTER, and not worse. Does it mean that I could take a 4 or 5 hour blood glucose test tomorrow and pass it with flying colors? NO, I don't think so. Does it mean that I can forget everything previously posted on this BLOG about diet, nutrition and exercise, PH factor etc.? No it does not. I did start cutting my glipizide in half and taking only half doses of Metformin while still in Ireland and do not see any escalating blood sugar readings as a result of that.

In John 5:14, Jesus said, "Go and sin no more, lest a worse thing come upon you"

I take that verse in part to mean, not to revert back to acid forming foods, eating rich deserts, too many carbs, etc.

I will keep you posted on my progress. God bless.

Dan

Healing Of he Centurions Servant

One of the greatest faith based stories in the bible has to be the healing of the Centurion's Servant. Even Jesus admitted that he had NOT seen such great faith in all of Israel. First a little history on exactly what was a Roman Centurion.

Roman Centurion

"History, Facts and Information about Roman Centurion
The content of this article provides interesting history, facts and information about Roman Centurion. Read about the role and position of this officer in the Roman Army and the clothing he wore and the weapons he bore.

The Role of the Roman Centurion
The Roman centurion was equivalent to a Captain in the Roman Army. The Roman Centurion was often of the humblest origin; he had been promoted from the ranks simply on account of bravery and military efficiency. At the drill, on the march, and in battle, they were at the same time the role models and the leaders of the soldiers. The Roman centurion was a skilled professional who could be relied on to run a legion on campaign and in battle. Each centuria (century) had a centurion and eventually, following the army restructure by the Roman general Gaius Marius (157 BC–January 13, 86 BC) there were 60 centurions in a legion.

Roman Centurion commanded a centuria (100 soldiers)A centuria was commanded by a centurion and consisted of 100 Roman soldiers. Centuriae were grouped by pairs forming maniples, which were then grouped in cohorts.

• 1 Legion = 10 Cohorts
• 1 Cohort = 6 centuriae
• 1 Manipulus = 2 Centuria
• 1 Centuria = 10 Contubernia
• 1 Contubernia = 10 Soldiers

Each Roman centurion had the option to appoint a second-in-command known as 'optios' - Optio literally means 'chosen one'. Other junior officers reporting directly to the centurion was standard bearer and signifier for each century'."

(My Input)

The centurion as mentioned in Matthew 8:5-13 was accustomed to speaking things into being as far as his authority in the Roman Army was concerned. His recognized  Jesus authority in healing and simply accepted his position and ability to speak healing to his servant.

Dan

Matthew 8:5-13 (New International Version, ©2011)

The Faith of the Centurion

" ⁵ When Jesus had entered Capernaum, a centurion came to him, asking for help. ⁶ “Lord,” he said, “my servant lies at home paralyzed, suffering terribly.”  ⁷ Jesus said to him, “Shall I come and heal him?”
 ⁸ The centurion replied, “Lord, I do not deserve to have you come under my roof. But just say the word, and my servant will be healed. ⁹ For I myself am a man under authority, with soldiers under me. I tell this one, ‘Go,’ and he goes; and that one, ‘Come,’ and he comes. I say to my servant, ‘Do this,’ and he does it.”
 ¹⁰ When Jesus heard this, he was amazed and said to those following him, “Truly I tell you, I have not found anyone in Israel with such great faith. ¹¹ I say to you that many will come from the east and the west, and will take their places at the feast with Abraham, Isaac and Jacob in the kingdom of heaven. ¹² But the subjects of the kingdom will be thrown outside, into the darkness, where there will be weeping and gnashing of teeth.”
 ¹³ Then Jesus said to the centurion, “Go! Let it be done just as you believed it would.” And his servant was healed at that moment."

This same healing is available today as God is the same yesterday, today and forever.


Dan
 

Bible Story Of Two Blind men Healed

Here is another in a series of "Faith Based Thinking" healing accounts from scripture. This one involves two blind men who asked Jesus to have mercy on them. Again FAITH was needed from the two blind men. Faith is NOT passive, it is ACTIVE.

Matthew 9:27-31 (King James Version)

 ²⁷And when Jesus departed thence, two blind men followed him, crying, and saying, Thou son of David, have mercy on us.
 ²⁸And when he was come into the house, the blind men came to him: and Jesus saith unto them, Believe ye that I am able to do this? They said unto him, Yea, Lord.
 ²⁹Then touched he their eyes, saying, According to your faith be it unto you.
 ³⁰And their eyes were opened; and Jesus straitly charged them, saying, See that no man know it.
 ³¹But they, when they were departed, spread abroad his fame in all that country.


One of the things about having type 2 diabetes  that disturbs me is that the medical community at large, the FDA and the American Diabetes Association in general will tell you there is NO cure for Type 2 Diabetes. I refuse to accept that based on the possibility of being healed by the Lord based on one's faith.

In the case above of the two blind men, He asked them point blank, "Believe ye that I am able to do this?" to which they replied, "YEA LORD".

He then touched their eyes and said, "According to your FAITH be it unto you".

I do NOT have all the answers, nor do I pretend to. I do KNOW THIS...........................

Hebrews 13:8 (New International Version, ©2011)

⁸ Jesus Christ is the same yesterday and today and forever. 

Dan

Bible Story Of Healing the man With the Withered hand

Here is a faith based story from the bible of the man with the withered hand. What has always struck me about this story is that as I examined healings throughout the scriptures, Jesus always required some ACTION on the part of the person being healed unless the person were unconscious or possessed  or in the case of raising someone from the dead, well................dead (incapable of conscious thought on their part).

It isn't that Jesus could not heal without your participation, however He always requested the person who was being healed to participate with the above mentioned exceptions. I am NOT a biblical scholar. Just another guy who loves the Lord and believes in his voluntary death on the cross for the remission of  my sins.

Here is the essence of what happened in Mark 3:3

MAN WITH THE WITHERED HAND

One Sabbath-day Jesus went into the synagogue, and there he saw a man that had a withered hand. By some means the muscles had lost their power, and he could neither use his hand nor stretch it out.
And the Pharisees watched Jesus, to see if He would heal this man on the Sabbath, that they might bring a charge against Him of breaking the law. They asked Him, "Is it lawful to heal on the Sabbath-day?" and He replied by asking who among them, if he had a sheep which had fallen into a pit on the Sabbath-day, would not lay hold on it, and lift it out. "How much then is a man better than a sheep? Wherefore it is lawful to do good on the Sabbath-day."

Then said He to the man, "Stretch for thine hand." And he stretched it forth, and it was made whole and healthy like the other.

Then the Pharisees went out and held a council against Him, to consider how they might destroy Him; but when Jesus knew it, He withdrew Himself from that part, and great multitudes followed Him, and He healed them all.

(My Input) I believe that Jesus could snap his fingers, or blink his eyes, or simply say the words, "Be thou healed to every diabetic on the planet" if he choose to. I have to believe that out there somewhere are stories about just that. There have been people healed of all manner of disease throughout the bible and it is still happening today. Jesus did NOT heal his hand first and then say to him, "Give that hand a try, see if it feels any better" He asked him to STRETCH FORTH THY HAND before he healed him. He was asking the man for a demonstration of FAITH.

I am writing this blog for (2) reasons:

• It forces me to do my homework and research so I can pass what I have learned along to you in order for you to take action and benefit from it
• It helps me to stay on track and eat less, and exercise more. it helps me to be more selective in the type of foods I eat and the type of exercise I do. In Hosea 4:6 it says

"My people are destroyed for lack of knowledge: because thou hast rejected knowledge, I will also reject thee, that thou shalt be no priest to me: seeing thou hast forgotten the law of thy God, I will also forget thy children."

"Make no little plans, they have no energy to stir the blood" Daniel Burnham

Dan

You Are Unique

What is faith? Let's look at Hebrews 11:1  "Now faith is the substance of things hoped for, the evidence of things not  seen"

Another favorite of mine is, "Faith is the bird, that feels the dawn, and sings while it is yet dark"

There are a lot of scriptures in the bible dealing with faith. One I know says that "The measure of faith is given to every man" in Romans 12:3.

We also know,  Without faith it is impossible to please God as found  in Hebrews 11:6
  King James Version:  "But without faith it is impossible to please him, for he that cometh to God must believe that he is, and that he is a rewarder of them that diligently seek him"

I have faith that in writing this BLOG, I will be healed of type II diabetes and God willing, a lot of others who follow this blog will also be healed. That is my prayer every night before I go to bed. May God Bless you and have mercy on you and heal you of your diseases including but not limited to diabetes.

I would like to share another scripture for everyone out there.

3 John 1:2

Viewing the 1769 King James Version. Click to switch to 1611 King James Version of 3 John 1:2

Beloved, I wish above all things that thou mayest prosper and be in health, even as thy soul prospereth.

Let's summarize thus far: We cannot please God without faith, so therefore God provided for us in that He gave each one of us the measure of faith. he is also a rewarder of them that diligently seek him. His greatest wish is that we would prosper and be in health even as our soul prospereth.

HE wants us to prosper and to be in good health. Our soul prospers as we "diligently seek Him".

We are created in His image and we are unique. there are currently as of 2009 an estimated 6.5 billion people on planet earth. Total number of people who ever lived from Adam to present day is estimated to be 120 billion. Amazing isn't it? The real amazing part comes in when you realize NO ONE ever had exactly the same finger prints as another person. Let's go one better. How many people on earth share the exact same DNA code? The answer is the same as finger prints. NONE. Look at this excerpt from an article on DNA identification: (link) see link for details:

Link To Uniqueness of DNA

	DNA/CRIMINAL JUSTICE

How Can DNA Sequences Identify Individuals?

1

2

3

4

5

Most people share very similar gene sequences, but some regions of DNA sequence have been found to vary from person to person with high frequency. Comparing variation in these regions allows us to answer the question of whether two different DNA samples come from the same person.
The FBI’s forensic DNA identification system probes thirteen such regions in the genome. Sequences in these special regions involve multiple repetitions of short combinations of letters, such as GATA. Easily detectable differences between people lie in the number of repeats that occur in both copies of their DNA in these regions. For example, at one of these regions a person might have inherited four repeats (GATAGATAGATAGATA) from their father and six repeats (GATAGATAGATAGATAGATAGATA) from their mother at the same location in the genome. Another person might inherit eight repeats (GATAGATAGATAGATAGATAGATAGATAGATA) from their father and five repeats (GATAGATAGATAGATAGATA) from their mother.
When two DNA samples match completely in a large number of regions, such as the 13 used in the FBI’s CODIS system, the probability that they could have come from two unrelated people is virtually zero. This fact makes DNA identification extremely reliable.

Still don't think you are unique? Let's look at another scripture.

Luke 12;7 "Indeed, the very hairs on your head are all numbered. Don't be afraid, you are worth more than many sparrows"

Let's face it. We are all different. We are all similar, in that barring birth defects. crippling, disfiguring accidents, etc. we all have 10 fingers, 10 toes, two legs, two eyes, two hands etc. We are pretty easy to identify at a distance that we are human, male or female etc.

On the other hand, we are unique enough that God knows every one of us by name, and he knows how many hairs each one of us have on our heads. He also died on the cross at Calvary for each and every one of us for individually for the remission of our sins. He also spoke to us in Jeremiah 29:11 to tell us: "For I know the plans I have for you, declares the Lord, plans to prosper you, and not to harm you, plans to give you a hope and a future"

I encourage you to praise the lord for your uniqueness, and thank Him for His plans for you, because He wants to prosper you and he wants you to be in good health. Now, why would I ask you to praise the Lord for your health and that you welcome the plans HE has for you? Good question. In Psalm 22:3 and in 114:2, we are told, "GOD in habits HIS praises". What does that mean? It means that God DWELLS in the atmosphere of HIS Praise, making praise a vehicle of faith which brings us into the presence and power of God.  SEE:

http://www.victorious.org/praise.htm

There is NO better place to be, than in the presence and power of God. This is place where you can experience divine healing. In future posts, I am going to share stories from scripture of divine healing and faith.

My prayer is that these posts will bless you and bring you closer to the Lord.

Dan